ERJ
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Permissions
Right arrowRequest Permissions
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (22)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ferrarotti, I.
Right arrow Articles by Luisetti, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ferrarotti, I.
Right arrow Articles by Luisetti, M.
Eur Respir J 2003; 21:444-449
Copyright ©ERS Journals Ltd 2003

Tumour necrosis factor family genes in a phenotype of COPD associated with emphysema

I. Ferrarotti1, M. Zorzetto1, M. Beccaria1, L.S. Gilè2, R. Porta2, N. Ambrosino2, P.F. Pignatti3, I. Cerveri1, E. Pozzi1 and M. Luisetti1

1 Dept of Respiratory Diseases, IRCCS San Matteo Hospital, University of Pavia, Pavia, 2 S. Maugeri Foundation, Scientific Institute of Gussago (BS), Gussago, 3 Biology and Genetics Unit, DMIBG, University of Verona, Verona, Italy

CORRESPONDENCE: M. Luisetti, Laboratorio di Biochimica e Genetica, Clinica di Malattie dell'Apparato Respiratorio, IRCCS Policlinico San Matteo, Via Taramelli 5, 27100, Pavia, Italy. Fax: 39 0382502269. E-mail: m.luisetti@smatteo.pv.it

Keywords: association Study, candidate gene, complex traits, gene polymorphisms, polymerase chain reaction

Received: June 14, 2002
Accepted October 23, 2002

This work was supported by grants from Ricerca Corrente of IRCCS Policlinico San Matteo, Italian CNR Target Project Biotechnology, the Italian Ministry of University and Research, and Fondazione Cariplo.


   Abstract
TOP
 Abstract
Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 
Genetic factors are believed to play a role in the individual susceptibility to chronic obstructive pulmonary disease (COPD). Tumour necrosis factor (TNF) family genes have been widely investigated but inconsistent results may lie either in the genetic heterogeneity of populations or in the poor phenotype definition. A genetic study was performed using a narrower phenotype of COPD.

The authors studied 86 healthy smokers and 63 COPD subjects who were enrolled based on irreversible airflow obstruction (forced expiratory volume in one second/forced vital capacity <70% predicted) and a diffusing capacity for carbon monoxide <50% predicted (moderate-to-severe COPD associated with pulmonary emphysema). The following polymorphisms were investigated: TNF-308, the biallelic polymorphism located in the first intron of the lymphotoxin-{alpha} gene, and exon 1 and exon 6 of the TNF receptor 1 and 2 genes, respectively.

No significant deviations were found concerning the four polymorphisms studied between the two populations.

The authors confirm that the tumour necrosis factor family genes, at least for the polymorphisms investigated, are not major genetic risk factors for chronic obstructive pulmonary disease in Caucasians, either defined in terms of emphysema (this study) or airflow obstruction (previous studies). Nevertheless, the authors would like to emphasise the importance of narrowing the phenotype in the search for genetic risk factors in chronic obstructive pulmonary disease.

Chronic obstructive pulmonary disease (COPD), a worldwide leading cause of mortality and morbidity, is a complex trait arising from the effects of environmental risk factors, mostly tobacco smoking, on susceptible individuals. In an attempt to further understand the role of genetic factors accounting for individual COPD susceptibility, a number of gene polymorphisms have been investigated in the last few years, including {alpha}1-antitrypsin-deficient variants in an intermediate status, microsomal epoxide hydrolase, glutathione-S-transferase, tumour necrosis factor (TNF) gene complex, and haemoxygenase. However, many of the associations found with COPD are controversial, since they have not been replicated in different populations 1–3.

Studies of TNF gene complex, coding for cytokines relevant to the pathophysiology of COPD 2, are the most abundant reports on this issue available in the literature, and they are a peculiar example of such inconsistent results. It was previously reported that the frequency of allele 2 (TNF-308*2), of the biallelic polymorphism located within the promoter region of the TNF-{alpha} gene (TNF-308), associated with higher levels of TNF production 4, was significantly higher in the Taiwanese with chronic bronchitis 5 and in the Japanese with COPD 6 than in appropriate controls. In marked contrast, the association with COPD was rejected by similarly planned case-control studies in Italian 7 and British 8 populations and by a longitudinal study focused on decline of lung function within the Lung Health Study in Northern Americans 9.

A likely explanation for these inconsistent results lies in genetic heterogeneity among different populations, a feature that is well known in other ubiquitous disorders, such as sarcoidosis 10. However, another critical point in planning a genetic investigation on a complex trait is the phenotype choice, and poor definition of the phenotype and/or heterogeneity of the condition are likely to reduce the power to find significant association 11. COPD is a widely heterogeneous condition 12, 13, including pulmonary emphysema, chronic bronchitis, and bronchial hyperreactivity, often in combination 14. Therefore, it cannot be ruled out that an incomplete definition of the phenotype underlies inconsistency in results of genetic studies on COPD 15 and those dealing with the TNF gene in particular.

Working on this assumption and given the lack of association of allele 2 of the TNF-308 (TNF-308*2) with COPD in another Japanese study 16, and the findings of Keatings et al. 17 who identified a COPD phenotype, i.e. poor prognosis possibly associated with the same allele in the British population, the present authors decided to re-evaluate the role of the TNF family genes in the Italian COPD population. In order to do this, a new COPD population was recruited, characterised by narrower functional inclusion criteria: irreversible airflow obstruction and a diffusing capacity <50% predicted, the latter of which was assumed to be a surrogate marker for pulmonary emphysema. The authors evaluated the frequency of the TNF-308 polymorphism and that of the biallelic polymorphism (Lt{alpha}NcoI) located in the first intron of the lymphotoxin-{alpha} gene (Lt-{alpha}, previously referred to as TNF-ß), in which allele 1 (Lt{alpha}NcoI*1) is associated with higher levels of TNF production 18, and compared the results with those obtained in appropriate controls. The investigation was also expanded in the two populations by adding an investigation of two biallelic polymorphisms of the TNF receptors 1 and 2 (TNFR1 and TNFR2, also referred to as p55 TNFR and p75 TNFR, respectively), which are type-I membrane ligands on the cell surface for both TNF-{alpha} and Lt-{alpha} 19. TNFR1 and TNFR2 genes are also thought to be candidate genes involved in mediating the numerous TNF-{alpha} and Lt-{alpha} effector functions 20.


   Subjects and methods
TOP
 Abstract
 Subjects and methods
Results
 Discussion
 Acknowledgements
 References
 
All individuals gave their consent prior to entering the study, which was approved by the Local Ethical Committees of the Institutions involved.

Design of the study
The investigation was designed as a case-control association study with candidate genes, a powerful approach for finding genetic determinants of a complex disorder such as COPD 15, 21.

Subjects and inclusion criteria
A total of 149 subjects, divided in two groups, with all Caucasians of Italian descent, were investigated. The first group of subjects consisted of 63 consecutive male patients with history of COPD, diagnosed according to the American Thoracic Society (ATS) guidelines 22 and characterised by significant impairment in diffusing capacity for carbon monoxide (DL,CO), a functional abnormality known to be associated with pulmonary emphysema 23, 24. These patients were recruited in two clinical centres, 33 in Pavia and 30 in Gussago, both located in Northern Italy, based on a common protocol requiring forced expiratory volume in one second (FEV1) <50% pred, <12% reversible, FEV1/forced vital capacity (FVC) <70% pred, and DL,CO <50% pred. To narrow the phenotype, patients fulfilling the first three criteria, but with a DL,CO >50% were excluded from the study.

The second group consisted of 86 healthy male current or former smokers who served as a control group. They were recruited from the clinical staff and from a cohort of blood donors. A periodic medical survey (including medical examination, questionnaire, blood and urine chemistry, chest radiography, and pulmonary function tests) excluded any diseases.

Pulmonary function tests
Lung volumes were measured by water-sealed spirometers. Measurements were performed according to the European Community for Steel and Coal statements 25 and the ATS recommendations 26. The best FVC measurement was recorded, as was the FEV1, and the FEV1/FVC calculated. DL,CO was determined using the single-breath method and corrected for haemoglobin content, as described previously 25, 26. Since correction of DL,CO for alveolar volume did not influence the results of the analysis, only uncorrected DL,CO values are reported.

Genetic analysis
Genomic deoxyribonucleic acid (DNA) was extracted from whole blood by standard methods. For detection of TNF-308 and Lt{alpha}NcoI polymorphisms in COPD and healthy control populations, the same primers 18 and conditions adopted in previous investigations 7 were used. For the TNFR1 exon 1 polymorphism, the polymerase chain reaction (PCR) conditions were as follows: PCR amplifications were carried out in a total volume of 25 µl containing 100 ng genomic DNA, 0.5 unit Thermus Aqiaticus (Taq) DNA polymerase (Laboratoires Eurobio, Les Ulis Cèdex, France), 0.5 µM of each PCR primer, 1.5 mM MgCl2, 200 µM of each dNTP, 67 mM Tris-HCl pH 8.8, 16 mM (NH4)SO4, and 0.01% Tween. Amplification was performed using a Gene Amp system 2400 (Perkin Elmer,Norwalk, CT, USA) with the following conditions: initial incubation at 95°C for 5 min, followed by 35 cycles each of 1 min at 95°C, 1 min at 60°C and 1 min at 72°C, and a final incubation at 72°C for 5 min. The primers used were forward 5' GAGCCCAAATGGGGGAGTGAGAGG 3' and reverse 5' ACCAGGCCCGGGCAGGAGAG 3' 27. The size of the PCR fragment product was 183 base pairs (bp). Restriction fragment length polymorphism (RFLP) analysis identified a single-nucelotide polymorphism (SNP) at position 36 (A->G), which creates a recognition site for the restriction enzyme MspA1 I (New England Biolabs, Beverly, MA, USA) when the G allele, but not the A allele, is present 27. The G allele digestion generates restriction fragments of 108 and 75 bp from the PCR products (fig. 1Go).



View larger version (90K):
[in this window]
[in a new window]
  		Fig. 1.— a) Restriction analysis of tumour necrosis factor receptor (TNFR)1 exon 1 polymorphism resolved in 2% agarose gel electrophoresis of polymerase chain reaction (PCR) amplified genomic deoxyribonucleic acid. A 183 base pair (bp) product (A allele) is restricted by the enzyme MspA1 I to fragments of 108 and 75 bp (G allele). Lane 1: molecular weight marker (GeneRuler 100 bp, Fermentas, Vilnius, Lithuana); lane 2: heterozygous AG; lane 3: homozygous AA; lane 4: homozygous GG. b) Restriction analysis of TNFR2 exon 6 polymorphism resolved in 2% agarose gel electrophoresis. Restriction of a 242 bp PCR product (allele R) with the enzyme Nla III results in fragments of 133 and 109 bp (allele M). Lane 1: homozygous MM; lane 2: homozygous RR; lane 3: heterozygous RM; lane 4: molecular weight marker.

 
For the TNFR2 exon 6 polymorphism, the PCR conditions were the same as above. Primers used were: forward 5' ACTCTCCTATCCTGCCTGCT 3' and reverse 5' TTCTGGAGTTGGCTGCGTTGT 3' 27. The size of the PCR fragment generated was 242 base pairs. RFLP analysis identified an SNP at position 196 (T->G), which creates a recognition site for the restriction enzyme Nla III (New England Biolabs) when the T allele, but not the G allele, is present. This polymorphism results in an amino acid substitution (Met->Arg). The 242 base pair PCR product is uncleaved in the 196 G allele (also called the R allele), and cleaved into two fragments of 133 and 109 bp in the 196 T allele (also called the M allele) 28 (fig. 1Go).

Statistical analysis
Clinical data are presented as mean±sd and differences among study groups were assessed by two-tailed Student's t-tests. Frequencies of the polymorphisms were compared with Chi-squared test and Fisher's exact test, and differences considered statistically significant when the p-value was <0.05. Hardy-Weinberg's equilibrium was assessed by goodness-of-fit Chi-squared test for biallelic markers. Correspondence analysis 29 was used to explore the interactions among the four genes investigated simultaneously. The population used in this study was large enough to have the statistical power to detect an allele that imparted an odds ratio of 2.5 given a 0.10 prevalence for the TNF-308 polymorphism, a 0.80 prevalence for the Lt{alpha}NcoI polymorphism, a 0.40 prevalence for the TNFR1 polymorphism, and a 0.70 prevalence for the TNFR2 polymorphisms in the COPD population.


   Results
TOP
 Abstract
 Subjects and methods
 Results
Discussion
 Acknowledgements
 References
 
Characteristics of the study populations
The COPD group included 63 subjects, all males aged 69±8 yrs. Fifty patients in this group were former smokers, and 13 current smokers, with a smoking history of 51±30 pack-yrs. The control group comprised 86 healthy smokers, all males aged 58±12 yrs. Forty-nine subjects of this group were former smokers, and 37 current smokers, with a smoking history of 34±21 pack-yrs.

Pulmonary function testing data of the study populations are reported in table 1Go. According to the recently published Global initiative for Chronic Obstructive Lung Disease report 30, COPD patients were characterised, in terms of severity, by moderate-to-severe COPD (Stage II–III). The mean±sd FEV1 reversibility in these subjects was 4±4. The low level of DL,CO in the COPD group (37±12% pred) allowed them to be defined as affected by moderate-to-severe COPD (Stage II–III) associated with pulmonary emphysema 23, 24.


View this table:
[in this window]
[in a new window]
  		Table 1— Functional characteristics of the populations studied

 
Genetic analysis
All genotypes of control and COPD groups agreed with the Hardy-Weinberg equilibrium. With reference to the TNF-308 polymorphism, the results obtained in the COPD population defined in terms of COPD associated with emphysema were consistent with the authors' previous findings and with those obtained by others in Caucasian subjects defined in terms of airflow obstruction, showing no different distribution of both genotypes and alleles with respect to the distribution in controls (table 2Go). Table 3Go shows the data concerning the investigation of the TNFR1 and TNFR2 polymorphisms. No significant deviations between the two groups were observed concerning either the allele or the genotype frequencies.


View this table:
[in this window]
[in a new window]
  		Table 2— Frequencies of tumour necrosis factor (TNF)-308 polymorphisms and the biallelic polymorphism located in the first intron of the lymphotoxin-{alpha} gene (Lt{alpha}NcoI) in the two populations studied

 

View this table:
[in this window]
[in a new window]
  		Table 3— Frequencies of tumour necrosis factor receptor (TNFR)1 exon 1 nt 36 and TNFR2 exon 6 nt 196 polymorphisms in the two populations studied

 
Results in the COPD group did not change after stratification by severity of respiratory impairment and correspondence analysis failed to reveal combinations of genotypes in the COPD group with significant deviations with respect to controls (data not shown).


   Discussion
TOP
 Abstract
 Subjects and methods
 Results
 Discussion
Acknowledgements
 References
 
Phenotype choice and biological reasonability of candidate genes are crucial prerequisites for a genetic investigation on a complex trait such as COPD 21. All previously published papers, including the authors' 5–8, 16, 17, dealing with the TNF gene family in COPD, have used FEV1 as an objective parameter to define the phenotype. FEV1 is strongly related to COPD 15 and predictive of all-cause mortality in population-based studies 31. Nevertheless, FEV1 is relatively nonspecific, reflecting many different aspects of lung pathology in COPD 32, and it does not help provide a better definition of these patients affected by a widely heterogeneous condition 12–14. In an attempt to narrow the phenotype choice to COPD-associated pulmonary emphysema, a severe reduction of DL,CO was used as an inclusion criterion. FEV1 % pred is weakly related to the extent of emphysema 24, 33, 34, suggesting that flow obstruction in severe COPD is not totally accounted for by the extent of emphysema. Reduction of DL,CO is more strongly correlated with the severity of emphysema, as assessed by high-resolution computed tomography analysis 24, reflecting the reduction of the alveolar-capillary surface, although with some limitations 24, 35.

The biological reasonability of the TNF family as candidate genes in COPD has already been emphasised 2, 36. TNF-{alpha} levels are increased in sputum of COPD patients 37, and weight loss in COPD has been associated with increased levels of circulating TNF-{alpha} 38. The potential implications of the two TNF-{alpha} and Lt-{alpha} polymorphisms investigated have already been extensively discussed 1–3, 5–9. In this article, for the first time, the authors have added the genetic study of two other TNF family members, TNFR1 and TNFR2, biologically reasonable candidates involved in mediating a number of TNF-{alpha} and LT-{alpha} effector functions 19. The soluble form of TNFR1 has been shown to correlate with leptin plasma concentration, in turn related to lower fat mass, in emphysema, but not in chronic bronchitis 39. The TNFR2 exon 6 polymorphism investigated in the present paper was previously found to be associated with human narcolepsy in the Japanese 40, and with systemic lupus erythematosus (SLE) 41 and rheumatoid arthritis in British patients 42, but not with SLE in either Spanish or British populations 28 or idiopathic pulmonary fibrosis 43 in British patients.

In the present paper, the authors provide evidence that the two alleles of the TNF-{alpha} and Lt-{alpha} genes (TNF-308*2 and Lt{alpha}NcoI*1, respectively), related to higher constitutional production of both cytokines, are not linked to moderate-to-severe COPD associated with emphysema in Italians. When the present study was planned, it was debated whether inconsistent results in different populations with respect to association of TNF-308*2 allele with COPD was due to a bias related to heterogeneity of COPD patients. In fact, the paper by Sakao et al. 6 reported a positive association with Japanese COPD patients with chronic obstruction in whom a history of chronic bronchitis had been excluded, thus suggesting, even if not clearly stated in the paper, that those patients were mostly affected by emphysema. By contrast, a positive association with the TNF-308*2 allele was found in Taiwanese subjects meeting the criteria for chronic bronchitis 5. However, it must be underlined that neither study provided any objective verification of the presence (or absence) of emphysema. The negative study reported by Higham et al. 8 in British subjects did not use DL,CO as an inclusion criterion, but reported a mean±sem of 75±4% pred in their series of 86 COPD patients, a much less severe impairment than that found in the present series (mean±sd 37±12).

TNF receptor polymorphisms were first studied in COPD in the present paper. The data, however, allows rejection of the hypothesis that they are a major genetic risk factor for COPD, at least that defined in terms of pulmonary emphysema.

In this paper, the authors focused attention on biologically reasonable polymorphic sites, such as the TNF-308 polymorphism of the TNF-{alpha} gene and the Lt{alpha}NcoI polymorphism of the Lt-{alpha} gene, as well as on a polymorphic site whose gene product is of unknown biological effect, such as TNFR2 exon 6 polymorphism, but that has been reported previously to be associated with a number of disorders 40–42. However, a number of other polymorphic sites are described within the TNF family genes 43, 44 and, therefore, their involvement in COPD cannot be excluded.

To conclude, these findings seem to confirm that the polymorphisms of tumour necrosis factor family genes related to higher constitutional production of cytokines are not major genetic determinants for chronic obstructive pulmonary disease in Caucasians, thus confirming the previously reported negative data in this ethnic group. In spite of the negative results from the investigation, the authors would like to stress the importance of narrowing the phenotype spectrum in a heterogeneous condition such as chronic obstructive pulmonary disease. This concept is further strengthened by two recent, independent reports 45, 46, which dealt with linkage analysis of quantitative spirometric phenotypes and demonstrated that forced expiratory volume in one second, forced vital capacity, and forced expiratory volume in one second/forced vital capacity are influenced by different loci. Another strategy would be to introduce a different phenotype of chronic obstructive pulmonary disease, such as qualitative and quantitative assessment of pulmonary emphysema by high-resolution computed tomography scan.


   Acknowledgements
TOP
 Abstract
 Subjects and methods
 Results
 Discussion
 Acknowledgements
References
 
A. De Silvestri's assistance in the statistical analysis and R. Stenner's assistance in editing this manuscript are gratefully acknowledged.


   References
TOP
 Abstract
 Subjects and methods
 Results
 Discussion
 Acknowledgements
 References
 

  1. Sandford AJ, Weir TD, Paré PD. Genetic risk factors for chronic obstructive pulmonary disease. Eur Respir J 1997;10:1380–1391.[Abstract]
  2. Barnes PJ. Molecular genetics of chronic obstructive pulmonary disease. Thorax 1999;54:245–252.[Free Full Text]
  3. Lomas DA, Silverman EK. The genetics of chronic obstructive pulmonary disease. Respir Res 2001;2:20–26.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  4. Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of a polymorphism in the human tumor necrosis factor {alpha} promoter on transcriptional activation. Proc Natl Acad Sci USA 1997;94:3195–3199.[Abstract/Free Full Text]
  5. Huang S-L, Su C-H, Chang S-C. Tumor necrosis factor-{alpha} gene polymorphism in chronic bronchitis. Am J Respir Crit Care Med 1997;156:1436–1439.[Abstract/Free Full Text]
  6. Sakao S, Tatsumi K, Igari H, Shino Y, Shirasawa H, Kuriyama T. Association of tumor necrosis factor {alpha} gene promoter polymorphism with the presence of chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2001;163:420–422.[Abstract/Free Full Text]
  7. Patuzzo C, Gilé LS, Zorzetto M, et al. Tumor necrosis factor gene complex in COPD and disseminated bronchiectasis. Chest 2000;117:1353–1358.[Abstract/Free Full Text]
  8. Higham MA, Pride NB, Alikhan A, Morrell NW. Tumour necrosis factor-{alpha} gene promoter polymorphism in chronic obstructive pulmonary disease. Eur Respir J 2000;15:281–284.[Abstract]
  9. Sandford AJ, Chagani T, Weir TD, Connett JE, Anthonisen NR, Paré PD. Susceptibility genes for rapid decline of lung function in the Lung Health Study. Am J Respir Crit Care Med 2001;163:469–473.[Abstract/Free Full Text]
  10. Luisetti M, Beretta A, Casali L. Genetic aspects in sarcoidosis. Eur Respir J 2000;16:768–780.[Abstract]
  11. Iannuzzi MC, Maliarik M, Rybicki B. Genetic polymorphisms in lung disease: bandwagon or breakthrough?. Respir Res 2002;3:15.[CrossRef][Medline] [Order article via Infotrieve]
  12. O'Brien C, Guest PJ, Hill SL, Stockley RA. Physiological and radiological characterisation of patients diagnosed with chronic obstructive pulmonary disease in primary care. Thorax 2000;55:635–642.[Abstract/Free Full Text]
  13. Widzicha JA. The heterogeneity of chronic obstructive pulmonary disease. Thorax 2000;55:631–632.[Free Full Text]
  14. Snider GL. Changes in COPD occurrence. Chronic obstructive pulmonary disease: a definition and implications of structural determinants of airflow obstruction for epidemiology. Am Rev Respir Dis 1989;140:S3–S8.[Web of Science][Medline] [Order article via Infotrieve]
  15. Hoidal JR. Genetics of COPD: present and future. Eur Respir J 2001;18:741–743.[Free Full Text]
  16. Ishii T, Matsuse T, Teramoto S, et al. Neither IL-1ß, IL-1 receptor antagonist, nor TNF-{alpha} polymorphisms are associated with susceptibility to COPD. Respir Med 2000;94:847–851.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  17. Keatings VM, Cave SJ, Henry MJ, et al. A polymorphism in the tumor necrosis factor-{alpha} gene promoter region may predispose to a poor prognosis in COPD. Chest 2000;118:971–975.[Abstract/Free Full Text]
  18. Messer G, Spengler U, Jung MC, et al. Polymorphic structure of the tumor necrosis factor (TNF) locus: an NcoI polymorphism in the first intron of the human TNF-{alpha} gene correlates with a variant amino acid in position 26 and a reduced level of TNF-{alpha} production. J Exp Med 1991;173:209–219.[Abstract/Free Full Text]
  19. Chan FK-M, Siegel RM, Lenardo MJ. Signaling by the TNF receptor superfamily and T cell homeostasis. Immunity 2000;13:419–422.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  20. Sedgwick JD, Riminton DS, Cyster JG, Körner H. Tumor necrosis factor: a master-regulator of leukocyte movement. Immunol Today 2000;21:110–113.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  21. Silverman EK, Palmer LJ. Case-control associations studies for the genetics of complex respiratory disorders. Am J Respir Cell Mol Biol 2000;22:645–648.[Free Full Text]
  22. American Thoracic Society. Standards for the diagnosis and care of patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 1995;152:S77–S120.
  23. Morrison NJ, Abboud RT, Ramadan F, et al. Comparison of single breath carbon monoxide diffusing capacity and pressure-volume curves in detecting emphysema. Am Rev Respir Dis 1989;139:1179–1187.[Web of Science][Medline] [Order article via Infotrieve]
  24. Baldi S, Miniati M, Bellina CR, et al. Relationship between extent of pulmonary emphysema by high-resolution computer tomography and lung elastic recoil in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2001;164:585–589.[Abstract/Free Full Text]
  25. Quanjer PH, Tammeling GJ, Cotes JE, Pedersen OF, Peslin R, Yernault JC. Lung volumes and forced ventilatory flows. Report Working Party Standardization for lung volumes tests, European Community for Steel and Coal. Official Statement of the European Respiratory Society. Eur Respir J 1993;6:Suppl. 16, 5–40.[Medline] [Order article via Infotrieve]
  26. American Thoracic Society. Standardization of spirometry. Am J Respir Crit Care Med 1995;152:1107–1136.[Web of Science][Medline] [Order article via Infotrieve]
  27. Pitts SA, Olomolaiye OO, Elson CJ, Westacott CI, Bidwell JL. An MspA1 I polymorphism in exon 1 of the human TNF receptor type I (p55) gene. Eur J Immunogenet 1998;25:269–270.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  28. Al-Ansari AS, Ollier WER, Villareal J, Ordi J, Teh L-S, Hajeer AH. Tumor necrosis factor receptor II (TNFRII) exon 6 polymorphism in systemic lupus erythematosus. Tissue Antigens 2000;55:97–99.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  29. Pauwels RA, Buist SA, Calverly PM, Jenkins CR, Hurd SS, the GOLD Scientific Committee. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease. NHLBI/WHO global initiative for chronic obstructive lung disease (GLD) workshop summary. Am J Respir Crit Care Med 2001;163:1256–1276.[Free Full Text]
  30. Fellenberg K, Hauser NC, Brors B, Neutzner A, Hoheisel JD, Vingron M. Correspondence analysis applied to microarray data. Proc Natl Acad Sci USA 2001;98:10781–10786.[Abstract/Free Full Text]
  31. Sorlie PD, Kannel WB, O'Connor GT. Mortality associated with respiratory function and symptoms: the Framingham Study. Am Rev Respir Dis 1989;140:379–384.[Web of Science][Medline] [Order article via Infotrieve]
  32. Dowson LJ, Guest PJ, Hill SL, Holder RL, Stockley RA. High-resolution computed tomography scanning in {alpha}1-antitrypsin deficiency: relationship to lung function and health status. Eur Respir J 2001;17:1097–1104.[Abstract/Free Full Text]
  33. Gelb AF, Schein M, Kuei J, et al. Limited contribution of emphysema in advanced chronic obstructive pulmonary disease. Am Rev Respir Dis 1993;147:1157–1611.[Web of Science][Medline] [Order article via Infotrieve]
  34. Gelb AF, Zamel N, Hogg JC, Müller NL, Schein M. Pseudophysiologic emphysema resulting from severe small-airways disease. Am J Respir Crit Care Med 1998;158:815–819.[Abstract/Free Full Text]
  35. Gelb AF, Hogg JC, Müller NL, et al. Contribution of emphysema and small airways in COPD. Chest 1996;109:353–359.[Abstract/Free Full Text]
  36. Barnes PJ. Chronic obstructive pulmonary disease. N Engl J Med 2000;343:269–280.[Free Full Text]
  37. Keatings VM, Collins PD, Scott PD, Barnes PJ. Differences in interleukin-8 and tumor necrosis factor-{alpha} in induced sputum from patients with chronic obstructive pulmonary disease or asthma. Am J Respir Crit Care Med 1996;152:1646–1652.
  38. Di Francia M, Barbier D, Mege JL, Orehek J. Tumor necrosis factor-{alpha} levels and weight loss in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 1994;150:1453–1455.[Abstract]
  39. Schols AMWJ, Creutzberg EC, Buurman WA, Campfield LA, Saris WHM, Wouters EFM. Plasma leptin is related to proinflammatory status and dietary intake in patients with chronic obstructive pulmonary disease. Am J Respir Crit Care Med 1999;160:1220–1226.[Abstract/Free Full Text]
  40. Hohjoh H, Terada N, Kawashima M, Honda Y, Tokunaga K. Significant association of the tumor necrosis factor receptor 2 (TNFR2) gene with narcolepsy. Tissue Antigens 2000;56:446–448.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  41. Komata T, Tsuchiya N, Matsushita M, Hagiwara K, Tokunaga K. Association of tumor necrosis factor receptor 2 (TNFR2) polymorphism with susceptibility to systemic lupus erythematosus. Tissue Antigens 1999;53:527–533.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  42. Barton A, John S, Ollier WER, Silman A, Worthington J. Association between rheumatoid arthritis and polymorphism of the tumor necrosis factor receptor II, but not tumor necrosis factor receptor I, in Caucasians. Arthritis Rheum 2001;44:61–65.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  43. Pantelidis P, Fanning GC, Wells AU, Welsh KI, du Bois RM. Analysis of tumor necrosis factor-{alpha}, lymphotoxin-{alpha}, tumor necrosis factor receptor II, and interleukin-6 polymorphisms in patients with idiopathic pulmonary fibrosis. Am J Respir Crit Care Med 2001;163:1432–1436.[Abstract/Free Full Text]
  44. Pantelidis A, Lympany PA, Foley PJ, Fanning GC, Welsh KI, du Bois RM. Polymorphic analysis of the high-affinity tumor necrosis factor receptor 2. Tissue Antigens 1999;54:585–591.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  45. Joost O, Wilk JB, Cupples LA, et al. Genetic loci influencing lung function. A genomwide scan in the Framingham Study. Am J Respir Crit Care Med 2002;165:795–799.[Abstract/Free Full Text]
  46. Silverman EK, Palmer LJ, Mosley JD, et al. Genomwide linkage analysis of quantitative spirometric phenotypes in severe early-onset chronic obstructive pulmonary disease. Am J Hum Genet 2002;70:1229–1239.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]



This article has been cited by other articles:


Home page
 ThoraxHome page
S J Marciniak and D A Lomas
What can naturally occurring mutations tell us about the pathogenesis of COPD?
Thorax, April 1, 2009; 64(4): 359 - 364.
[Abstract] [Full Text] [PDF]

Home page
 Proc Am Thorac SocHome page
C. P. Hersh, D. L. DeMeo, and E. K. Silverman
National Emphysema Treatment Trial State of the Art: Genetics of Emphysema
Proceedings of the ATS, May 1, 2008; 5(4): 486 - 493.
[Abstract] [Full Text] [PDF]

Home page
 Eur Respir JHome page
M. R. Gingo, L. J. Silveira, Y. E. Miller, A. L. Friedlander, G. P. Cosgrove, E. D. Chan, L. A. Maier, and R. P. Bowler
Tumour necrosis factor gene polymorphisms are associated with COPD
Eur. Respir. J., May 1, 2008; 31(5): 1005 - 1012.
[Abstract] [Full Text] [PDF]

Home page
 Occup. Environ. Med.Home page
H. Zhang, J. Hang, X. Wang, W. Zhou, B. Sun, H. Dai, L. Su, and D. C Christiani
TNF polymorphisms modify endotoxin exposure-associated longitudinal lung function decline
Occup. Environ. Med., June 1, 2007; 64(6): 409 - 413.
[Abstract] [Full Text] [PDF]

Home page
 Eur Respir JHome page
H. M. Boezen and D. S. Postma
Tumour necrosis factor and lymphotoxin A polymorphisms: a relationship with COPD and its progression?
Eur. Respir. J., January 1, 2007; 29(1): 8 - 10.
[Full Text] [PDF]

Home page
 Eur Respir JHome page
J. Brogger, V. M. Steen, H. G. Eiken, A. Gulsvik, and P. Bakke
Genetic association between COPD and polymorphisms in TNF, ADRB2 and EPHX1.
Eur. Respir. J., April 1, 2006; 27(4): 682 - 688.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
C. P. Hersh, D. L. DeMeo, C. Lange, A. A. Litonjua, J. J. Reilly, D. Kwiatkowski, N. Laird, J. S. Sylvia, D. Sparrow, F. E. Speizer, et al.
Attempted Replication of Reported Chronic Obstructive Pulmonary Disease Candidate Gene Associations
Am. J. Respir. Cell Mol. Biol., July 1, 2005; 33(1): 71 - 78.
[Abstract] [Full Text] [PDF]

Home page
 Proc Am Thorac SocHome page
S. I. Rennard
Clinical Approach to Patients with Chronic Obstructive Pulmonary Disease and Cardiovascular Disease
Proceedings of the ATS, April 1, 2005; 2(1): 94 - 100.
[Abstract] [Full Text] [PDF]

Home page
 Pharmacol. Rev.Home page
P. J. Barnes
Mediators of Chronic Obstructive Pulmonary Disease
Pharmacol. Rev., December 1, 2004; 56(4): 515 - 548.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
G. H. Gibbons, C. C. Liew, M. O. Goodarzi, J. I. Rotter, W. A. Hsueh, H. M. Siragy, R. Pratt, and V. J. Dzau
Genetic Markers: Progress and Potential for Cardiovascular Disease
Circulation, June 29, 2004; 109(25_suppl_1): IV-47 - IV-58.
[Full Text] [PDF]

Home page
 ChestHome page
N. A. Molfino
Genetics of COPD
Chest, May 1, 2004; 125(5): 1929 - 1940.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Permissions
Right arrowRequest Permissions
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (22)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ferrarotti, I.
Right arrow Articles by Luisetti, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ferrarotti, I.
Right arrow Articles by Luisetti, M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS